Interception of Citrus Viroid on Imported Orange from Republic of China and Lime from Cambodia

Abstract

Citrus viroids are an important group of pathogens that can cause various abnormal symptoms on citrus such as stunting, bark scaling, yellowing and epinasty of leaves stem pitting and gumming. They have never been found in Thailand. Recently, a great number of orange and lime fruits are imported from China and Cambodia respectively, which may lead to risk of viroid disease distribution. Inspection of the samplings of orange and lime fruits from June 2013 to May 2014. Citrus exocortis viroid (CEVd), Hop stunt viroid (HSVd), Citrus bent leaf viroid (CBLVd) and Citrus viroid III (CVd III) were determined using RT-PCR technique with specific PCR primer pairs. Only CBLVd and CVd III were detected with the CBLVd primers (c-CBLVd: GTCGACGACGACCAGTCAGCTCC / h-CBLVd: GAAGGCTCGTCAGCTGCGGAGG) and the CVd3 primers (c- CVd3: GTCGACGACGACAGGTAAG TTCCC / h- CVd3: GTCGACGACGACAGGTAAGTTCCC), which clearly generated amplification bands of Thai Agricultural Research Journal Vol. 32 No. 3 September - December 2014 253around 320 and 300 base pairs, respectively. The presence of CBLVd and CVd III were confirmed by DNA sequencing and RNA secondary structure analysis. About 34.2% and 19.5% of 41 samples of imported lime fruit were infected with CBLVd and CVd III, respectively. In imported orange, CBLVd was detected for 62.3% of total fruit, whilst CVd III was found in 75.3%. This result indicates that CBLVd and CVd III present at a relatively high incidence in the imported citrus fruit. In addition, both viroid diseases are not yet found in Thailand and lack of information which leads to difficulties in determining their impact and for conducting pest risk analysis.