Development of Detection Technique for Grapevine yellow speckle viroid 1 and 2 (GYSVd-1 and 2) Causing Grapevine Yellow Speckle Disease by RT-PCR method

Abstract

Grapevine yellow speckle viroid 1 (GYSVd-1) and Grapevine yellow speckle viroid 2 (GYSVd-2) are serious grapevine plant pathogens causing “grapevine yellow speckle disease” which are commonly found in several grapevine plantation areas. These viroids can transmit by contaminated plant materials or agricultural tools simply which leads them to easily and rapidly spread. Therefore, development for efficient and accurate diagnostic method is necessary for prevention from an impact of these viroids. In February and March 2014, yellow spot (speckle) symptom on leaves was found in several grapevine plantations in Saraburi and Nakhon Ratchasima provinces. By development of molecular technique, total RNA extracted from the twenty collected samples by CTAB method, they were determined by RT-PCR technique using the GYSVd1 primers (c-GYSVd1: CGAGGCTCACTCCCCCTCTGCC / h-GYSVd1: TCGTCGACGAAGGGGTGCACTCC) and the GYSVd2 (upper) primers (c-GYSVd2 (upper): GGTCCGCGGAGGCCTTCCGAGG / h-GYSVd2 (upper): TGCAGAGAAAAGAAGAA GGGCCCAG). Then the PCR products were cloned, sequenced and analyzed. The results revealed that six and eleven samples of the collected grapevine leaves were GYSVd-1 and GYSVd-2 and the variants ranged in size from 353-389 as well as 362-365 nucleotides, respectively. The GYSVd1 and GYSVd-2 sequences also shared 93-99% and 98-99% homology with the GYSVd-1 and GYSVd- 2 in GenBank database, respectively. To our knowledge, this is the first report of GYSVd-2 natural infection in grapevine plants in Thailand.